Examples of org.broadinstitute.gatk.utils.recalibration.covariates.CycleCovariate

Package org.broadinstitute.gatk.utils.recalibration.covariates

Examples of org.broadinstitute.gatk.utils.recalibration.covariates.CycleCovariate

org.broadinstitute.gatk.utils.recalibration.covariates.CycleCovariate
Created by IntelliJ IDEA. User: rpoplin Date: Oct 30, 2009 The Cycle covariate. For Solexa the cycle is simply the position in the read (counting backwards if it is a negative strand read) For 454 the cycle is the TACG flow cycle, that is, each flow grabs all the TACG's in order in a single cycle For example, for the read: AAACCCCGAAATTTTTACTG the cycle would be 11111111222333333344 For SOLiD the cycle is a more complicated mixture of ligation cycle and primer round

    RecalibrationArgumentCollection RAC;


    @BeforeClass
    public void init() {
        RAC = new RecalibrationArgumentCollection();
        covariate = new CycleCovariate();
        covariate.initialize(RAC);
    }

View Full Code Here

TOP

Related Classes of org.broadinstitute.gatk.utils.recalibration.covariates.CycleCovariate

org.broadinstitute.gatk.utils.NGSPlatform

org.broadinstitute.gatk.utils.recalibration.CycleCovariateUnitTest

org.broadinstitute.gatk.utils.exceptions.UserException

All source code are property of their respective owners. Java is a trademark of Sun Microsystems, Inc and owned by ORACLE Inc. Contact coftware#gmail.com.